Delta Variant (B.1.617.2) Spike Expression Vectors

Optimized SARS-CoV-2 Spike gene (B.1.617.2 - Indian origin) for mammalian cell expression

pUNO1-SpikeV8 and pUNO1-SpikeV8-dfur plasmids have been specifically designed for the expression of the SARS-CoV-2 Spike (S) protein in mammalian cells with either a functional or inactivated furin (dfur) cleavage site. These plasmids encode the full-length Spike sequence from the Delta variant (B.1.617.2), and for optimal cellular expression, it is codon-optimized and the C‑terminal ER-retention signal has been removed [1, 2].

Delta Variant (B.1.617.2 lineage) Spike Expression vectors
for cell fusion and flow cytometry assays

Gene Description

These plasmids encode the Spike protein from the SARS-CoV-2 Delta variant, first reported in October 2020 in India. This variant is classified as a member of Clade 21A/ B.1.617.2 lineage (Nextstrain/Pango lineage classification). It is characterized by the presence of a number of mutations within the Spike coding region, of which, several are of concern [3,4].

• S1 domain: T19R, T95I, G142D, E156G, deletion (Δ)F157-R158, D614G, P681R
• RBD: L452R, T478K
• S2 domain: D950N

Learn more about SARS-CoV-2 Variants

The Spike protein contains a furin cleavage site that affects its cellular expression [5, in-house data]. Therefore, depending on your application InvivoGen offers:

• pUNO1-SpikeV8: with a functional furin cleavage site and recommended for Spike/ACE2 cell fusion assays
• pUNO1-SpikeV8-dfur: with an inactive furin (dfur) cleavage site for improved surface expression and detection (flow cytometry)

 More details

General Plasmid Description

These plasmids feature a potent mammalian expression cassette composed of the ubiquitous human EF1α-HTLV composite promoter and the SV40 polyadenylation (pAn) signal.  The codon-optimized ORF includes the native SARS-CoV-2 Spike signal sequence. The plasmids are selectable with Blasticidin in both E. coli and mammalian cells (transient and stable transfection).

Applications

• Spike-mediated cell fusion assays with pUNO1-SpikeV8
• Cell surface detection by flow cytometry with pUNO1-SpikeV8-dfur
• Screening of SARS-CoV-2 inhibitors including small molecules, monoclonal antibodies, or convalescent plasma

References:

1. Johnson, M.C. et al. 2020. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J Virol 94.
2. Ou, X. et al. 2020. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620.
3. Davis, C. et al. 2021. Reduced neutralisation of the Delta (B.1.617.2) SARS-CoV-2 variant of concern following vaccination. medRxiv doi:10.1101/2021.06.23.21259327.
4. Centers for Disease Control and Prevention. SARS-CoV-2 Variant Classifications and Definitions. Retrieved 07 July 2021.
5. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.

Figures

InvivoGen's anti-SARS-CoV2RBD mAbs allow the detection of Spike surface expression by mammalian cells for a set of SARS-CoV-2 variants of concern.
Human embryonic kidney (HEK)-293 cells featuring stable cell surface expression of Spike variants were incubated with either Anti-CoV2RBD-cas-mIgG2a, Anti-CoV2RBD-imd-mIgG2a, Anti-CoV2RBD-bam-mIgG2a, or Anti-CoV2RBD-ete-mIgG2a mAbs for 1 hour at 4°C. Cells were then washed and incubated with a PE-conjugated goat anti-murine IgG for 1 hour at 4°C, and surface staining was analyzed by FACS. The grey line indicates the maximal fluorescence intensity for unstained cells.

Specifications

pUNO1-SpikeV8

• Origin: Delta Variant (B.1.617.2 lineage)
• Sequence Reference:  EPI_ISL_2356230
• Codon Optimized
• ORF size: 3759 bp
• Sequencing primers:
  - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
  - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
• Quality Control:
  - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
  - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

pUNO1-SpikeV8-dfur

• Origin: Delta Variant (B.1.617.2 lineage)
• Sequence Reference: EPI_ISL_2356230
• Codon Optimized and R683/5A mutations
• ORF size: 3759 bp
• Sequencing primers:
  - Forward HTLV 5’UTR: TGCTTGCTCAACTCTACGTC
  - Reverse SV40 pAn: AACTTGTTTATTGCAGCTT
• Quality Control:
  - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
  - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

Contents

pUNO1-SpikeV8 and pUNO1-SpikeV8-dfur are provided as follows:

Please note: Each plasmid is sold separately. 

• 20 μg of lyophilized DNA
• 2 x 1 ml Blasticidin at 10 mg/ml

 The product is shipped at room temperature.

Lyophilized DNA should be stored at -20 °C.

Resuspended DNA should be stored at -20 °C and is stable for up to 1 year.

Blasticidin is a harmful compound. Refer to the safety data sheet for handling instructions. Store Blasticidin at 4 °C or -20 °C for up to two years. The product is stable for 2 weeks at 37 °C.

Avoid repeated freeze-thaw cycles.

Details

Furin cleavage site in the SARS-CoV-2 Spike protein

A furin cleavage sequence (RRxR) is found within a polybasic cleavage site (681-PRRSR/SVA-688) at the boundary between the S1 and S2 domains (S1/S2) of the Spike protein [1]. Furin is enriched in the Golgi apparatus, where it functions to cleave proteins into their 'mature/active forms'. Specifically, it is suggested that cleavage at this site by furin pre-primes the SARS-CoV-2 S protein during its production. This allows further processing by cell surface host proteases (e.g. TMPRSS2)  upon binding to ACE2, which ultimately facilitates viral-host membrane fusion [2,3].

► In a mammalian expression system (e.g. HEK293 cells), to maximize the surface expression of the S protein, the furin cleavage site in InvivoGen's pUNO1-SpikeV8-dfur has been inactivated (in-house data). The crucial recognition residues have been mutated (R683A and R685A) ensuring that the S protein is not cleaved by furin. 

Furthermore, the S protein possesses cell-cell fusogenic activity and has been shown to trigger large syncytia formation (multi-nucleated cells). Notably, overexpression of an uncleavable S protein (mutated/inactivated furin cleavage site) has been shown to not induce cell-cell fusion, suggesting that cleavage at the multibasic site is a requirement for syncytia formation [3].

► To study cell-cell fusion by the SARS-CoV-2 spike, InvivoGen offers the pUNO1-SpikeV8 plasmid. 

References:

1. Coutard, B. et al. 2020. The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176, 104742.
2. Johnson, B.A. et al. 2021. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature
3. Papa, G. et al. 2021. Furin cleavage of SARS-CoV-2 Spike promotes but is not essential for infection and cell-cell fusion. PLoS Pathog 17, e1009246.

Citations